ALDH2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52760-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH2 Reagents
CRO Services
Product recommended

All ALDH2 Reagents
ALDH2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1560 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase 2, mitochondrial with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Ahd-5 cDNA ORF Clone, Mouse;Ahd5 cDNA ORF Clone, Mouse
ALDH2 Background Information
Full Name
aldehyde dehydrogenase 2 family (mitochondrial)

ALDH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Rat RG81479-G

ALDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Mouse MG52760-G
ALDH2 cDNA ORF Clone, Mouse, untagged MG52760-UT
ALDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52760-ACGLN
ALDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52760-ACG
ALDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52760-ACR
ALDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52760-CF
ALDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52760-NF
ALDH2 cDNA ORF Clone, Mouse, C-His tag MG52760-CH
ALDH2 cDNA ORF Clone, Mouse, N-His tag MG52760-NH
ALDH2 cDNA ORF Clone, Mouse, C-HA tag MG52760-CY
ALDH2 cDNA ORF Clone, Mouse, N-HA tag MG52760-NY
ALDH2 cDNA ORF Clone, Mouse, N-Myc tag MG52760-NM

ALDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Human HG12064-G
ALDH2 cDNA ORF Clone, Human, untagged HG12064-UT
ALDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12064-ACGLN
ALDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12064-ACG
ALDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12064-ANG
ALDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12064-ACR
ALDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12064-ANR
ALDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12064-CF
ALDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12064-NF
ALDH2 cDNA ORF Clone, Human, C-His tag HG12064-CH
ALDH2 cDNA ORF Clone, Human, N-His tag HG12064-NH
ALDH2 cDNA ORF Clone, Human, C-HA tag HG12064-CY
ALDH2 cDNA ORF Clone, Human, N-HA tag HG12064-NY
ALDH2 cDNA ORF Clone, Human, C-Myc tag HG12064-CM
ALDH2 cDNA ORF Clone, Human, N-Myc tag HG12064-NM
ALDH2 qPCR Primer Pairs, Human HP101595
info info
添加购物车成功! 添加购物车失败!