ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52196-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ALDH7A1 Reagents

CRO Services

Product recommended


All ALDH7A1 Reagents

ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase family 7, member A1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

Atq1 cDNA ORF Clone, Mouse;D18Wsu181e cDNA ORF Clone, Mouse

ALDH7A1 Background Information

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

Full Name
aldehyde dehydrogenase 7 family, member A1
References
  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • ALDH7A1 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    ALDH7A1 cDNA ORF Clone in Cloning Vector, Rabbit TG65129-G
    ALDH7A1 cDNA ORF Clone, Rabbit, untagged TG65129-UT
    ALDH7A1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65129-ACGLN
    ALDH7A1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65129-ACG
    ALDH7A1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65129-ANG
    ALDH7A1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65129-ACR
    ALDH7A1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65129-ANR
    ALDH7A1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65129-CF
    ALDH7A1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65129-NF
    ALDH7A1 cDNA ORF Clone, Rabbit, C-His tag TG65129-CH
    ALDH7A1 cDNA ORF Clone, Rabbit, N-His tag TG65129-NH
    ALDH7A1 cDNA ORF Clone, Rabbit, C-HA tag TG65129-CY
    ALDH7A1 cDNA ORF Clone, Rabbit, N-HA tag TG65129-NY
    ALDH7A1 cDNA ORF Clone, Rabbit, C-Myc tag TG65129-CM
    ALDH7A1 cDNA ORF Clone, Rabbit, N-Myc tag TG65129-NM

    ALDH7A1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ALDH7A1 cDNA ORF Clone in Cloning Vector, Rat RG81356-G

    ALDH7A1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ALDH7A1 cDNA ORF Clone in Cloning Vector, Mouse MG52196-G
    ALDH7A1 cDNA ORF Clone, Mouse, untagged MG52196-UT
    ALDH7A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52196-ACGLN
    ALDH7A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52196-ACG
    ALDH7A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52196-ANG
    ALDH7A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52196-ACR
    ALDH7A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52196-ANR
    ALDH7A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52196-NF
    ALDH7A1 cDNA ORF Clone, Mouse, C-His tag MG52196-CH
    ALDH7A1 cDNA ORF Clone, Mouse, N-His tag MG52196-NH
    ALDH7A1 cDNA ORF Clone, Mouse, C-HA tag MG52196-CY
    ALDH7A1 cDNA ORF Clone, Mouse, N-HA tag MG52196-NY
    ALDH7A1 cDNA ORF Clone, Mouse, C-Myc tag MG52196-CM
    ALDH7A1 cDNA ORF Clone, Mouse, N-Myc tag MG52196-NM
    ALDH7A1 qPCR Primer Pairs, Mouse MP202069

    ALDH7A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALDH7A1 cDNA ORF Clone in Cloning Vector, Human HG11614-M
    ALDH7A1 cDNA ORF Clone, Human, untagged HG11614-UT
    ALDH7A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11614-ACG
    ALDH7A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11614-ACGLN
    ALDH7A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11614-ANG
    ALDH7A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11614-ACR
    ALDH7A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11614-ANR
    ALDH7A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11614-CF
    ALDH7A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11614-NF
    ALDH7A1 cDNA ORF Clone, Human, C-His tag HG11614-CH
    ALDH7A1 cDNA ORF Clone, Human, N-His tag HG11614-NH
    ALDH7A1 cDNA ORF Clone, Human, C-HA tag HG11614-CY
    ALDH7A1 cDNA ORF Clone, Human, N-HA tag HG11614-NY
    ALDH7A1 cDNA ORF Clone, Human, C-Myc tag HG11614-CM
    ALDH7A1 cDNA ORF Clone, Human, N-Myc tag HG11614-NM
    ALDH7A1 qPCR Primer Pairs, Human HP101440
    info info
    添加购物车成功! 添加购物车失败!