After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse ALOX5AP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009663.1
cDNA 크기:486bp
cDNA 설명:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal HA tag.
유전자 동의어:Flap
:Mouse
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG52815-ACG265260
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG52815-ACR265260
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그MG52815-ANG265260
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그MG52815-ANR265260
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG52815-CF229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-His 태그MG52815-CH229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-Myc 태그MG52815-CM229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, C-HA 태그MG52815-CY229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone in cloning vectorMG52815-G88420
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-Flag 태그MG52815-NF229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-His 태그MG52815-NH229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-Myc 태그MG52815-NM229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmid, N-HA 태그MG52815-NY229890
쥐 ALOX5AP / 5-lipoxygenase-activating 단백질 Gene ORF cDNA clone expression plasmidMG52815-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

참고자료
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Cat No: MG52815-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".