After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 APLP1 / Amyloid-like 단백질 1 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Mouse APLP1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_007467.3
cDNA 크기:1965bp
cDNA 설명:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor-like protein 1 with C terminal His tag.
유전자 동의어:Aplp1
:Mouse
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

참고자료
  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    Cat No: MG51730-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".