Apolipoprotein E cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51201-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Apolipoprotein E Reagents
CRO Services
Product recommended

All Apolipoprotein E Reagents
Apolipoprotein E cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse apolipoprotein E with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.98kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Apolipoprotein E cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Apolipoprotein E cDNA ORF Clone, Mouse, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Apolipoprotein E cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI255918 cDNA ORF Clone, Mouse;Apo-E cDNA ORF Clone, Mouse
Apolipoprotein E Background Information

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

Full Name
apolipoprotein E
References
  • Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.
  • Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.
  • Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.
  • Apolipoprotein E cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein E cDNA ORF Clone in Cloning Vector, Rat RG81874-U
    Apolipoprotein E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81874-ACGLN

    Apolipoprotein E cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein E cDNA ORF Clone in Cloning Vector, Mouse MG51201-U
    Apolipoprotein E cDNA ORF Clone, Mouse, untagged MG51201-UT
    Apolipoprotein E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51201-ACG
    Apolipoprotein E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51201-ACGLN
    Apolipoprotein E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51201-ACR
    Apolipoprotein E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51201-CF
    Apolipoprotein E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51201-NF
    Apolipoprotein E cDNA ORF Clone, Mouse, C-His tag MG51201-CH
    Apolipoprotein E cDNA ORF Clone, Mouse, N-His tag MG51201-NH
    Apolipoprotein E cDNA ORF Clone, Mouse, N-HA tag MG51201-NY
    Apolipoprotein E cDNA ORF Clone, Mouse, C-Myc tag MG51201-CM
    Apolipoprotein E cDNA ORF Clone, Mouse, N-Myc tag MG51201-NM
    Apolipoprotein E qPCR Primer Pairs, Mouse MP201085

    Apolipoprotein E cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein E cDNA ORF Clone in Cloning Vector, Human HG10817-M
    Apolipoprotein E cDNA ORF Clone, Human, untagged HG10817-UT
    Apolipoprotein E cDNA ORF Clone, Human, C-GFPSpark® tag HG10817-ACG
    Apolipoprotein E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10817-ACGLN
    Apolipoprotein E cDNA ORF Clone, Human, C-OFPSpark® tag HG10817-ACR
    Apolipoprotein E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10817-CF
    Apolipoprotein E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10817-NF
    Apolipoprotein E cDNA ORF Clone, Human, C-His tag HG10817-CH
    Apolipoprotein E cDNA ORF Clone, Human, N-His tag HG10817-NH
    Apolipoprotein E cDNA ORF Clone, Human, C-HA tag HG10817-CY
    Apolipoprotein E cDNA ORF Clone, Human, N-HA tag HG10817-NY
    Apolipoprotein E cDNA ORF Clone, Human, C-Myc tag HG10817-CM
    Apolipoprotein E cDNA ORF Clone, Human, N-Myc tag HG10817-NM
    Apolipoprotein E qPCR Primer Pairs, Human HP100722
    info info
    添加购物车成功! 添加购物车失败!