Text Size:AAA

쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-Flag 태그

    데이터시트리뷰관련제품프로토콜
     ARF2 cDNA 클론 제품 정보
    Gene_bank_ref_id:D87899.1
    cDNA 크기:546bp
    cDNA 설명:Full length Clone DNA of Mus musculus ADP-ribosylation factor 2 with C terminal Flag tag.
    유전자 동의어:Arf2
    :Mouse
    벡터:pCMV3-C-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ARF2 qPCR primers for gene expression analysis, MP201511 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG51638-ACG265260
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG51638-ACR265260
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그MG51638-ANG265260
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그MG51638-ANR265260
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG51638-CF229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-His 태그MG51638-CH229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-Myc 태그MG51638-CM229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, C-HA 태그MG51638-CY229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone in cloning vectorMG51638-G88420
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-Flag 태그MG51638-NF229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-His 태그MG51638-NH229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-Myc 태그MG51638-NM229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmid, N-HA 태그MG51638-NY229890
    쥐 ARF4/ADP-ribosylation factor 4 Gene ORF cDNA clone expression plasmidMG51638-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: MG51638-CF
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".