쥐 ATP6AP2/ATP6IP2 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
     ATP6AP2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_027439.4
    cDNA 크기:1053bp
    cDNA 설명:Full length Clone DNA of Mus musculus ATPase, H+ transporting, lysosomal accessory protein 2.
    유전자 동의어:M8-9, (P)RR, Atp6ip2, APT6M8-9, ATP6M8-9, 5730403E06Rik
    :Mouse
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATP6AP2 qPCR primers for gene expression analysis, MP201248 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Size / Price
    Cat No: MG51375-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".