Bad cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51444-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Bad Reagents

CRO Services

Product recommended


All Bad Reagents

Bad cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Mouse BCL2-associated agonist of cell death with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bad cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AI325008 cDNA ORF Clone, Mouse;Bbc2 cDNA ORF Clone, Mouse

Bad Background Information

Full Name
BCL2-associated agonist of cell death

Bad cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Rat RG81911-U
Bad Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81911-ACGLN

Bad cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Mouse MG51444-G
Bad cDNA ORF Clone, Mouse, untagged MG51444-UT
Bad Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51444-ACGLN
Bad cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51444-ACG
Bad cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51444-ANG
Bad cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51444-ACR
Bad cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51444-ANR
Bad cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51444-CF
Bad cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51444-NF
Bad cDNA ORF Clone, Mouse, C-His tag MG51444-CH
Bad cDNA ORF Clone, Mouse, N-His tag MG51444-NH
Bad cDNA ORF Clone, Mouse, C-HA tag MG51444-CY
Bad cDNA ORF Clone, Mouse, N-HA tag MG51444-NY
Bad cDNA ORF Clone, Mouse, C-Myc tag MG51444-CM
Bad qPCR Primer Pairs, Mouse MP201328

Bad cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bad cDNA ORF Clone in Cloning Vector, Human HG10020-M
Bad cDNA ORF Clone, Human, untagged HG10020-UT
Bad Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10020-ACGLN
Bad cDNA ORF Clone, Human, C-GFPSpark® tag HG10020-ACG
Bad cDNA ORF Clone, Human, N-GFPSpark® tag HG10020-ANG
Bad cDNA ORF Clone, Human, C-OFPSpark® tag HG10020-ACR
Bad cDNA ORF Clone, Human, N-OFPSpark® tag HG10020-ANR
Bad cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10020-CF
Bad cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10020-NF
Bad cDNA ORF Clone, Human, C-His tag HG10020-CH
Bad cDNA ORF Clone, Human, N-His tag HG10020-NH
Bad cDNA ORF Clone, Human, C-HA tag HG10020-CY
Bad cDNA ORF Clone, Human, N-HA tag HG10020-NY
Bad cDNA ORF Clone, Human, C-Myc tag HG10020-CM
Bad cDNA ORF Clone, Human, N-Myc tag HG10020-NM
Bad qPCR Primer Pairs, Human HP100117
info info
添加购物车成功! 添加购物车失败!