After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 BCHE/Butyrylcholinesterase Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Mouse BCHE cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009738.3
cDNA 크기:1812bp
cDNA 설명:Full length Clone DNA of Mus musculus butyrylcholinesterase with C terminal Flag tag.
유전자 동의어:MGC107651, C730038G20Rik, Bche
:Mouse
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

참고자료
  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • Size / Price
    Cat No: MG50418-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".