BMP-2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51115-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BMP-2 Reagents

CRO Services

Product recommended


All BMP-2 Reagents

BMP-2 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Description
Full length Clone DNA of Mouse bone morphogenetic protein 2 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP-2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

AI467020 cDNA ORF Clone, Mouse;AI467020a cDNA ORF Clone, Mouse;Bmp2 cDNA ORF Clone, Mouse;Bmp2a cDNA ORF Clone, Mouse

BMP-2 Background Information

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

Full Name
bone morphogenetic protein 2
References
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • BMP-2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Canine DG70088-G
    BMP-2 cDNA ORF Clone, Canine, untagged DG70088-UT
    BMP-2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70088-ACG
    BMP-2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70088-ACGLN
    BMP-2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70088-ACR
    BMP-2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70088-CF
    BMP-2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70088-NF
    BMP-2 cDNA ORF Clone, Canine, C-His tag DG70088-CH
    BMP-2 cDNA ORF Clone, Canine, N-His tag DG70088-NH
    BMP-2 cDNA ORF Clone, Canine, C-HA tag DG70088-CY
    BMP-2 cDNA ORF Clone, Canine, N-HA tag DG70088-NY
    BMP-2 cDNA ORF Clone, Canine, C-Myc tag DG70088-CM
    BMP-2 cDNA ORF Clone, Canine, N-Myc tag DG70088-NM

    BMP-2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Rhesus CG90041-G
    BMP-2 cDNA ORF Clone, Rhesus, untagged CG90041-UT
    BMP-2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90041-ACGLN
    BMP-2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90041-ACG
    BMP-2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90041-ACR
    BMP-2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90041-CF
    BMP-2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90041-NF
    BMP-2 cDNA ORF Clone, Rhesus, C-His tag CG90041-CH
    BMP-2 cDNA ORF Clone, Rhesus, N-His tag CG90041-NH
    BMP-2 cDNA ORF Clone, Rhesus, C-HA tag CG90041-CY
    BMP-2 cDNA ORF Clone, Rhesus, N-HA tag CG90041-NY
    BMP-2 cDNA ORF Clone, Rhesus, C-Myc tag CG90041-CM
    BMP-2 cDNA ORF Clone, Rhesus, N-Myc tag CG90041-NM

    BMP-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Mouse MG51115-G
    BMP-2 cDNA ORF Clone, Mouse, untagged MG51115-UT
    BMP-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51115-ACG
    BMP-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51115-ACGLN
    BMP-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51115-ACR
    BMP-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51115-G-F
    BMP-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51115-CF
    BMP-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51115-NF
    BMP-2 cDNA ORF Clone, Mouse, C-His tag MG51115-CH
    BMP-2 cDNA ORF Clone, Mouse, N-His tag MG51115-NH
    BMP-2 cDNA ORF Clone, Mouse, N-HA tag MG51115-NY
    BMP-2 cDNA ORF Clone, Mouse, C-Myc tag MG51115-CM
    BMP-2 cDNA ORF Clone, Mouse, N-Myc tag MG51115-NM
    BMP-2 qPCR Primer Pairs, Mouse MP201066

    BMP-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMP-2 cDNA ORF Clone in Cloning Vector, Human HG10426-G
    BMP-2 cDNA ORF Clone, Human, untagged HG10426-UT
    BMP-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10426-ACGLN
    BMP-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10426-ACG
    BMP-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10426-ACR
    BMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10426-CF
    BMP-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10426-NF
    BMP-2 cDNA ORF Clone, Human, C-His tag HG10426-CH
    BMP-2 cDNA ORF Clone, Human, N-His tag HG10426-NH
    BMP-2 cDNA ORF Clone, Human, C-HA tag HG10426-CY
    BMP-2 cDNA ORF Clone, Human, N-HA tag HG10426-NY
    BMP-2 cDNA ORF Clone, Human, C-Myc tag HG10426-CM
    BMP-2 cDNA ORF Clone, Human, N-Myc tag HG10426-NM
    BMP-2 qPCR Primer Pairs, Human HP100456

    BMP-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BMP-2 qPCR Primer Pairs, Rat RP300058
    info info
    添加购物车成功! 添加购物车失败!