BMP-3 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50508-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BMP-3 Reagents
CRO Services
Product recommended

All BMP-3 Reagents
BMP-3 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Mouse bone morphogenetic protein 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP-3 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
9130206H07 cDNA ORF Clone, Mouse;9530029I04Rik cDNA ORF Clone, Mouse
BMP-3 Background Information
Full Name
bone morphogenetic protein 3

BMP-3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BMP-3 cDNA ORF Clone in Cloning Vector, Rhesus CG90057-G
BMP-3 cDNA ORF Clone, Rhesus, untagged CG90057-UT
BMP-3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90057-ACGLN
BMP-3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90057-ACG
BMP-3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90057-ACR
BMP-3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90057-CF
BMP-3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90057-NF
BMP-3 cDNA ORF Clone, Rhesus, C-His tag CG90057-CH
BMP-3 cDNA ORF Clone, Rhesus, N-His tag CG90057-NH
BMP-3 cDNA ORF Clone, Rhesus, C-HA tag CG90057-CY
BMP-3 cDNA ORF Clone, Rhesus, N-HA tag CG90057-NY
BMP-3 cDNA ORF Clone, Rhesus, C-Myc tag CG90057-CM
BMP-3 cDNA ORF Clone, Rhesus, N-Myc tag CG90057-NM

BMP-3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BMP-3 cDNA ORF Clone in Cloning Vector, Rat RG80126-G
BMP-3 cDNA ORF Clone, Rat, untagged RG80126-UT
BMP-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80126-ACGLN
BMP-3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80126-ACG
BMP-3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80126-ACR
BMP-3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80126-CF
BMP-3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80126-NF
BMP-3 cDNA ORF Clone, Rat, C-His tag RG80126-CH
BMP-3 cDNA ORF Clone, Rat, N-His tag RG80126-NH
BMP-3 cDNA ORF Clone, Rat, C-HA tag RG80126-CY
BMP-3 cDNA ORF Clone, Rat, N-HA tag RG80126-NY
BMP-3 cDNA ORF Clone, Rat, C-Myc tag RG80126-CM
BMP-3 cDNA ORF Clone, Rat, N-Myc tag RG80126-NM
BMP-3 qPCR Primer Pairs, Rat RP300121

BMP-3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BMP-3 cDNA ORF Clone in Cloning Vector, Mouse MG50508-M
BMP-3 cDNA ORF Clone, Mouse, untagged MG50508-UT
BMP-3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50508-ACG
BMP-3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50508-ACGLN
BMP-3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50508-ACR
BMP-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50508-CF
BMP-3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50508-NF
BMP-3 cDNA ORF Clone, Mouse, C-His tag MG50508-CH
BMP-3 cDNA ORF Clone, Mouse, N-His tag MG50508-NH
BMP-3 cDNA ORF Clone, Mouse, N-HA tag MG50508-NY
BMP-3 cDNA ORF Clone, Mouse, C-Myc tag MG50508-CM
BMP-3 cDNA ORF Clone, Mouse, N-Myc tag MG50508-NM
BMP-3 qPCR Primer Pairs, Mouse MP200501

BMP-3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BMP-3 cDNA ORF Clone in Cloning Vector, Human HG13668-G
BMP-3 cDNA ORF Clone, Human, untagged HG13668-UT
BMP-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13668-ACGLN
BMP-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13668-ACG
BMP-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13668-ACR
BMP-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13668-CF
BMP-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13668-NF
BMP-3 cDNA ORF Clone, Human, C-His tag HG13668-CH
BMP-3 cDNA ORF Clone, Human, N-His tag HG13668-NH
BMP-3 cDNA ORF Clone, Human, C-HA tag HG13668-CY
BMP-3 cDNA ORF Clone, Human, N-HA tag HG13668-NY
BMP-3 cDNA ORF Clone, Human, C-Myc tag HG13668-CM
BMP-3 cDNA ORF Clone, Human, N-Myc tag HG13668-NM
BMP-3 qPCR Primer Pairs, Human HP102348
info info
添加购物车成功! 添加购物车失败!