Text Size:AAA

쥐 SynCam/CADM1/TSLC1/IGSF4 Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
     CADM1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_018770.3
    cDNA 크기:1338bp
    cDNA 설명:Full length Clone DNA of Mus musculus cell adhesion molecule 1 with N terminal HA tag.
    유전자 동의어:Bl2, ST17, Igsf4, Necl2, RA175, Tslc1, Igsf4a, RA175A, RA175B, RA175C, RA175N, SgIGSF, SynCam, AI987920, 2900073G06Rik, 3100001I08Rik, Cadm1
    :Mouse
    벡터:pCMV3-SP-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CADM1 qPCR primers for gene expression analysis, MP200530 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.

    참고자료
  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
  • Size / Price
    Cat No: MG50538-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".