쥐 Calmodulin 2 / CALM2 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
     CALM2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_007589.5
    cDNA 크기:450bp
    cDNA 설명:Full length Clone DNA of Mus musculus calmodulin 2.
    유전자 동의어:AL024017, 1500001E21Rik
    :Mouse
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CALM2 qPCR primers for gene expression analysis, MP201206 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

    참고자료
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Cat No: MG51329-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".