쥐 MCP-1/CCL2 Gene ORF cDNA clone expression plasmid, C-Myc 태그

  • Mouse CCL2 / MCP-1 natural ORF mammalian expression plasmid, C-Myc tag
데이터시트리뷰관련제품프로토콜
 CCL2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_011333.3
cDNA 크기:447bp
cDNA 설명:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 2 with C terminal Myc tag.
유전자 동의어:JE, HC11, MCAF, MCP1, MCP-1, Scya2, Sigje, SMC-CF, AI323594, Ccl2
:Mouse
벡터:pCMV3-C-Myc
Plasmid:pCMV3-mCCL2-Myc
제한 사이트:KpnI + XbaI (6kb + 0.49kb)
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CCL2 qPCR primers for gene expression analysis, MP200388 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
 CCL2 Gene Plasmid Map
Mouse CCL2 / MCP-1 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Monocyte chemoattractant protein 1 (MCP-1), also called CCL2, belongs to a group of CC chemokines located in chromosome 17q11.2. MCP-1 protein interacts with chemokine C-C motif receptor 2 (CCR2) to activate and recruit monocytes, macrophages, CD4+ T cells and immature dendritic cells to the site of infection [7–9]. The presence of MCP-1 protein in an adequate concentration is important for granuloma formation and M. tuberculosis clearance.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Size / Price
Cat No: MG50368-CM
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".