Cyclin B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51016-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Cyclin B2 Reagents

CRO Services

Product recommended


All Cyclin B2 Reagents

Cyclin B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Description
Full length Clone DNA of Mouse cyclin B2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

CycB2 cDNA ORF Clone, Mouse

Cyclin B2 Background Information

Full Name
cyclin B2

Cyclin B2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cyclin B2 cDNA ORF Clone in Cloning Vector, Rat RG86875-U
Cyclin B2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86875-ACGLN

Cyclin B2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclin B2 cDNA ORF Clone in Cloning Vector, Mouse MG51016-G
Cyclin B2 cDNA ORF Clone, Mouse, untagged MG51016-UT
Cyclin B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51016-ACGLN
Cyclin B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51016-ACG
Cyclin B2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51016-ANG
Cyclin B2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51016-ACR
Cyclin B2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51016-ANR
Cyclin B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51016-NF
Cyclin B2 cDNA ORF Clone, Mouse, C-His tag MG51016-CH
Cyclin B2 cDNA ORF Clone, Mouse, N-His tag MG51016-NH
Cyclin B2 cDNA ORF Clone, Mouse, C-HA tag MG51016-CY
Cyclin B2 cDNA ORF Clone, Mouse, N-HA tag MG51016-NY
Cyclin B2 cDNA ORF Clone, Mouse, C-Myc tag MG51016-CM
Cyclin B2 cDNA ORF Clone, Mouse, N-Myc tag MG51016-NM
Cyclin B2 qPCR Primer Pairs, Mouse MP200975

Cyclin B2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclin B2 cDNA ORF Clone in Cloning Vector, Human HG10918-M
Cyclin B2 cDNA ORF Clone, Human, untagged HG10918-UT
Cyclin B2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10918-ACG
Cyclin B2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10918-ACGLN
Cyclin B2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10918-ANG
Cyclin B2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10918-ACR
Cyclin B2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10918-ANR
Cyclin B2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10918-CF
Cyclin B2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10918-NF
Cyclin B2 cDNA ORF Clone, Human, C-His tag HG10918-CH
Cyclin B2 cDNA ORF Clone, Human, N-His tag HG10918-NH
Cyclin B2 cDNA ORF Clone, Human, C-HA tag HG10918-CY
Cyclin B2 cDNA ORF Clone, Human, N-HA tag HG10918-NY
Cyclin B2 cDNA ORF Clone, Human, C-Myc tag HG10918-CM
Cyclin B2 cDNA ORF Clone, Human, N-Myc tag HG10918-NM
Cyclin B2 qPCR Primer Pairs, Human HP100801
info info
添加购物车成功! 添加购物车失败!