Langerin cDNA ORF Clone, Mouse, untagged

Cat: MG50285-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Langerin Reagents
CRO Services
Product recommended

All Langerin Reagents
Langerin cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Mouse CD207 antigen.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Langerin Background Information
Full Name
CD207 molecule, langerin

Langerin cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Langerin cDNA ORF Clone in Cloning Vector, Rhesus CG90159-G
Langerin cDNA ORF Clone, Rhesus, untagged CG90159-UT
Langerin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90159-ACGLN
Langerin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90159-ACG
Langerin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90159-ACR
Langerin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90159-CF
Langerin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90159-NF
Langerin cDNA ORF Clone, Rhesus, C-His tag CG90159-CH
Langerin cDNA ORF Clone, Rhesus, N-His tag CG90159-NH
Langerin cDNA ORF Clone, Rhesus, C-HA tag CG90159-CY
Langerin cDNA ORF Clone, Rhesus, N-HA tag CG90159-NY
Langerin cDNA ORF Clone, Rhesus, C-Myc tag CG90159-CM
Langerin cDNA ORF Clone, Rhesus, N-Myc tag CG90159-NM

Langerin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Langerin cDNA ORF Clone in Cloning Vector, Rat RG80398-G
Langerin cDNA ORF Clone, Rat, untagged RG80398-UT
Langerin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80398-ACGLN
Langerin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80398-ACG
Langerin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80398-ACR
Langerin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80398-CF
Langerin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80398-NF
Langerin cDNA ORF Clone, Rat, C-His tag RG80398-CH
Langerin cDNA ORF Clone, Rat, N-His tag RG80398-NH
Langerin cDNA ORF Clone, Rat, C-HA tag RG80398-CY
Langerin cDNA ORF Clone, Rat, N-HA tag RG80398-NY
Langerin cDNA ORF Clone, Rat, C-Myc tag RG80398-CM
Langerin cDNA ORF Clone, Rat, N-Myc tag RG80398-NM
Langerin qPCR Primer Pairs, Rat RP300364

Langerin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Langerin cDNA ORF Clone in Cloning Vector, Mouse MG50285-M
Langerin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50285-ACG
Langerin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50285-ACGLN
Langerin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50285-ACR
Langerin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50285-CF
Langerin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50285-NF
Langerin cDNA ORF Clone, Mouse, C-His tag MG50285-CH
Langerin cDNA ORF Clone, Mouse, N-His tag MG50285-NH
Langerin cDNA ORF Clone, Mouse, C-HA tag MG50285-CY
Langerin cDNA ORF Clone, Mouse, N-HA tag MG50285-NY
Langerin cDNA ORF Clone, Mouse, C-Myc tag MG50285-CM
Langerin cDNA ORF Clone, Mouse, N-Myc tag MG50285-NM
Langerin qPCR Primer Pairs, Mouse MP200309

Langerin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Langerin cDNA ORF Clone in Cloning Vector, Human HG15688-G
Langerin cDNA ORF Clone, Human, untagged HG13040-UT
Langerin cDNA ORF Clone, Human, untagged HG15688-UT
Langerin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15688-ACGLN
Langerin cDNA ORF Clone, Human, C-GFPSpark® tag HG15688-ACG
Langerin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13040-ACGLN
Langerin cDNA ORF Clone, Human, C-OFPSpark® tag HG15688-ACR
Langerin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15688-CF
Langerin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15688-NF
Langerin cDNA ORF Clone, Human, C-His tag HG15688-CH
Langerin cDNA ORF Clone, Human, N-His tag HG15688-NH
Langerin cDNA ORF Clone, Human, C-HA tag HG15688-CY
Langerin cDNA ORF Clone, Human, N-HA tag HG15688-NY
Langerin cDNA ORF Clone, Human, C-Myc tag HG15688-CM
Langerin cDNA ORF Clone, Human, N-Myc tag HG15688-NM
Langerin qPCR Primer Pairs, Human HP103196
info info
添加购物车成功! 添加购物车失败!