CD72 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50732-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD72 Reagents

CRO Services

Product recommended


All CD72 Reagents

CD72 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Mouse CD72 antigen, transcript variant 2 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD72 cDNA ORF Clone, Mouse, N-His tag Alternative Names

CD72c cDNA ORF Clone, Mouse;Ly-19 cDNA ORF Clone, Mouse;Ly-32 cDNA ORF Clone, Mouse;Ly-m19 cDNA ORF Clone, Mouse;Lyb-2 cDNA ORF Clone, Mouse

CD72 Background Information

Full Name
CD72 molecule

CD72 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD72 cDNA ORF Clone in Cloning Vector, Mouse MG50732-G
CD72 cDNA ORF Clone in Cloning Vector, Mouse MG5A7600-U
CD72 cDNA ORF Clone, Mouse, untagged MG5A7600-UT
CD72 cDNA ORF Clone, Mouse, untagged MG50732-UT
CD72 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50732-ACGLN
CD72 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50732-ACG
CD72 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7600-ACG
CD72 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7600-ACGLN
CD72 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7600-ACR
CD72 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50732-ACR
CD72 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7600-CF
CD72 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50732-CF
CD72 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50732-NF
CD72 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7600-NF
CD72 cDNA ORF Clone, Mouse, C-His tag MG5A7600-CH
CD72 cDNA ORF Clone, Mouse, C-His tag MG50732-CH
CD72 cDNA ORF Clone, Mouse, N-His tag MG5A7600-NH
CD72 cDNA ORF Clone, Mouse, C-HA tag MG5A7600-CY
CD72 cDNA ORF Clone, Mouse, C-HA tag MG50732-CY
CD72 cDNA ORF Clone, Mouse, N-HA tag MG50732-NY
CD72 cDNA ORF Clone, Mouse, N-HA tag MG5A7600-NY
CD72 cDNA ORF Clone, Mouse, C-Myc tag MG5A7600-CM
CD72 cDNA ORF Clone, Mouse, C-Myc tag MG50732-CM
CD72 cDNA ORF Clone, Mouse, N-Myc tag MG50732-NM
CD72 cDNA ORF Clone, Mouse, N-Myc tag MG5A7600-NM
CD72 qPCR Primer Pairs, Mouse MP200707

CD72 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD72 cDNA ORF Clone, Human, untagged HG12507-UT
CD72 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12507-ACGLN
CD72 qPCR Primer Pairs, Human HP104826
info info
添加购物车成功! 添加购物车失败!