CDIP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51413-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CDIP1 Reagents
CRO Services
Product recommended

All CDIP1 Reagents
CDIP1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Mouse cell death inducing Trp53 target 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDIP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2700048O17Rik cDNA ORF Clone, Mouse;5730403B10Rik cDNA ORF Clone, Mouse;AU018521 cDNA ORF Clone, Mouse;AW742692 cDNA ORF Clone, Mouse;CDIP cDNA ORF Clone, Mouse
CDIP1 Background Information
Full Name
cell death-inducing p53 target 1

CDIP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDIP1 cDNA ORF Clone in Cloning Vector, Rat RG81052-U
CDIP1 cDNA ORF Clone, Rat, untagged RG81052-UT
CDIP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81052-ACG
CDIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81052-ACGLN
CDIP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81052-ANG
CDIP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81052-ACR
CDIP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81052-ANR
CDIP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81052-CF
CDIP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81052-NF
CDIP1 cDNA ORF Clone, Rat, C-His tag RG81052-CH
CDIP1 cDNA ORF Clone, Rat, N-His tag RG81052-NH
CDIP1 cDNA ORF Clone, Rat, C-HA tag RG81052-CY
CDIP1 cDNA ORF Clone, Rat, N-HA tag RG81052-NY
CDIP1 cDNA ORF Clone, Rat, C-Myc tag RG81052-CM
CDIP1 cDNA ORF Clone, Rat, N-Myc tag RG81052-NM
CDIP1 qPCR Primer Pairs, Rat RP301016

CDIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDIP1 cDNA ORF Clone in Cloning Vector, Mouse MG51413-G
CDIP1 cDNA ORF Clone, Mouse, untagged MG51413-UT
CDIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51413-ACGLN
CDIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51413-ACG
CDIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51413-ANG
CDIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51413-ACR
CDIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51413-ANR
CDIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51413-CF
CDIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51413-NF
CDIP1 cDNA ORF Clone, Mouse, C-His tag MG51413-CH
CDIP1 cDNA ORF Clone, Mouse, C-HA tag MG51413-CY
CDIP1 cDNA ORF Clone, Mouse, N-HA tag MG51413-NY
CDIP1 cDNA ORF Clone, Mouse, C-Myc tag MG51413-CM
CDIP1 cDNA ORF Clone, Mouse, N-Myc tag MG51413-NM
CDIP1 qPCR Primer Pairs, Mouse MP201297
info info
添加购物车成功! 添加购物车失败!