p35/CDK5R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51010-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All p35/CDK5R1 Reagents

CRO Services

Product recommended


All p35/CDK5R1 Reagents

p35/CDK5R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 5, regulatory subunit 1 (p35) with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p35/CDK5R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

Cdk5r cDNA ORF Clone, Mouse;D11Bwg0379e cDNA ORF Clone, Mouse;p25 cDNA ORF Clone, Mouse;p35 cDNA ORF Clone, Mouse

p35/CDK5R1 Background Information

Full Name
cyclin-dependent kinase 5, regulatory subunit 1 (p35)

p35/CDK5R1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
p35/CDK5R1 cDNA ORF Clone in Cloning Vector, Mouse MG51010-G
p35/CDK5R1 cDNA ORF Clone, Mouse, untagged MG51010-UT
p35/CDK5R1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51010-ACGLN
p35/CDK5R1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51010-ACG
p35/CDK5R1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51010-ANG
p35/CDK5R1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51010-ACR
p35/CDK5R1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51010-ANR
p35/CDK5R1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51010-NF
p35/CDK5R1 cDNA ORF Clone, Mouse, C-His tag MG51010-CH
p35/CDK5R1 cDNA ORF Clone, Mouse, N-His tag MG51010-NH
p35/CDK5R1 cDNA ORF Clone, Mouse, C-HA tag MG51010-CY
p35/CDK5R1 cDNA ORF Clone, Mouse, N-HA tag MG51010-NY
p35/CDK5R1 cDNA ORF Clone, Mouse, C-Myc tag MG51010-CM
p35/CDK5R1 cDNA ORF Clone, Mouse, N-Myc tag MG51010-NM
p35/CDK5R1 qPCR Primer Pairs, Mouse MP200970

p35/CDK5R1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p35/CDK5R1 cDNA ORF Clone in Cloning Vector, Human HG10922-M
p35/CDK5R1 cDNA ORF Clone, Human, untagged HG10922-UT
p35/CDK5R1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10922-ACG
p35/CDK5R1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10922-ACGLN
p35/CDK5R1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10922-ANG
p35/CDK5R1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10922-ACR
p35/CDK5R1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10922-ANR
p35/CDK5R1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10922-CF
p35/CDK5R1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10922-NF
p35/CDK5R1 cDNA ORF Clone, Human, C-His tag HG10922-CH
p35/CDK5R1 cDNA ORF Clone, Human, N-His tag HG10922-NH
p35/CDK5R1 cDNA ORF Clone, Human, C-HA tag HG10922-CY
p35/CDK5R1 cDNA ORF Clone, Human, N-HA tag HG10922-NY
p35/CDK5R1 cDNA ORF Clone, Human, C-Myc tag HG10922-CM
p35/CDK5R1 cDNA ORF Clone, Human, N-Myc tag HG10922-NM
p35/CDK5R1 qPCR Primer Pairs, Human HP100804
info info
添加购物车成功! 添加购物车失败!