CHMP2A cDNA ORF Clone, Mouse, N-His tag

Cat: MG52820-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHMP2A Reagents
CRO Services
Product recommended

All CHMP2A Reagents
CHMP2A cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Mouse charged multivesicular body protein 2A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHMP2A cDNA ORF Clone, Mouse, N-His tag Alternative Names
1500016L11Rik cDNA ORF Clone, Mouse
CHMP2A Background Information
Full Name
charged multivesicular body protein 2A

CHMP2A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHMP2A cDNA ORF Clone in Cloning Vector, Rat RG8A0722-U
CHMP2A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0722-ACGLN

CHMP2A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHMP2A cDNA ORF Clone in Cloning Vector, Mouse MG52820-G
CHMP2A cDNA ORF Clone, Mouse, untagged MG52820-UT
CHMP2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52820-ACGLN
CHMP2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52820-ACG
CHMP2A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52820-ANG
CHMP2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52820-ACR
CHMP2A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52820-ANR
CHMP2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52820-CF
CHMP2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52820-NF
CHMP2A cDNA ORF Clone, Mouse, C-His tag MG52820-CH
CHMP2A cDNA ORF Clone, Mouse, C-HA tag MG52820-CY
CHMP2A cDNA ORF Clone, Mouse, N-HA tag MG52820-NY
CHMP2A cDNA ORF Clone, Mouse, C-Myc tag MG52820-CM
CHMP2A cDNA ORF Clone, Mouse, N-Myc tag MG52820-NM

CHMP2A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHMP2A cDNA ORF Clone in Cloning Vector, Human HG14288-G
CHMP2A cDNA ORF Clone, Human, untagged HG14288-UT
CHMP2A cDNA ORF Clone, Human, C-GFPSpark® tag HG14288-ACG
CHMP2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14288-ACGLN
CHMP2A cDNA ORF Clone, Human, N-GFPSpark® tag HG14288-ANG
CHMP2A cDNA ORF Clone, Human, C-OFPSpark® tag HG14288-ACR
CHMP2A cDNA ORF Clone, Human, N-OFPSpark® tag HG14288-ANR
CHMP2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14288-CF
CHMP2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14288-NF
CHMP2A cDNA ORF Clone, Human, C-His tag HG14288-CH
CHMP2A cDNA ORF Clone, Human, N-His tag HG14288-NH
CHMP2A cDNA ORF Clone, Human, C-HA tag HG14288-CY
CHMP2A cDNA ORF Clone, Human, N-HA tag HG14288-NY
CHMP2A cDNA ORF Clone, Human, C-Myc tag HG14288-CM
CHMP2A cDNA ORF Clone, Human, N-Myc tag HG14288-NM
CHMP2A qPCR Primer Pairs, Human HP102938
info info
添加购物车成功! 添加购物车失败!