CHMP7 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52733-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CHMP7 Reagents

CRO Services

Product recommended


All CHMP7 Reagents

CHMP7 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1356 bp
Description
Full length Clone DNA of Mouse charged multivesicular body protein 7 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHMP7 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

4930596K11Rik cDNA ORF Clone, Mouse;6330407G04Rik cDNA ORF Clone, Mouse;AI450338 cDNA ORF Clone, Mouse;AW550775 cDNA ORF Clone, Mouse

CHMP7 Background Information

Full Name
charged multivesicular body protein 7

CHMP7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHMP7 cDNA ORF Clone in Cloning Vector, Mouse MG52733-G
CHMP7 cDNA ORF Clone, Mouse, untagged MG52733-UT
CHMP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52733-ACGLN
CHMP7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52733-ACG
CHMP7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52733-ANG
CHMP7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52733-ACR
CHMP7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52733-ANR
CHMP7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52733-CF
CHMP7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52733-NF
CHMP7 cDNA ORF Clone, Mouse, C-His tag MG52733-CH
CHMP7 cDNA ORF Clone, Mouse, N-His tag MG52733-NH
CHMP7 cDNA ORF Clone, Mouse, C-HA tag MG52733-CY
CHMP7 cDNA ORF Clone, Mouse, N-HA tag MG52733-NY
CHMP7 cDNA ORF Clone, Mouse, N-Myc tag MG52733-NM
CHMP7 qPCR Primer Pairs, Mouse MP202604

CHMP7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHMP7 cDNA ORF Clone in Cloning Vector, Human HG14273-G
CHMP7 cDNA ORF Clone, Human, untagged HG14273-UT
CHMP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14273-ACGLN
CHMP7 cDNA ORF Clone, Human, C-GFPSpark® tag HG14273-ACG
CHMP7 cDNA ORF Clone, Human, N-GFPSpark® tag HG14273-ANG
CHMP7 cDNA ORF Clone, Human, C-OFPSpark® tag HG14273-ACR
CHMP7 cDNA ORF Clone, Human, N-OFPSpark® tag HG14273-ANR
CHMP7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14273-CF
CHMP7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14273-NF
CHMP7 cDNA ORF Clone, Human, C-His tag HG14273-CH
CHMP7 cDNA ORF Clone, Human, N-His tag HG14273-NH
CHMP7 cDNA ORF Clone, Human, C-HA tag HG14273-CY
CHMP7 cDNA ORF Clone, Human, N-HA tag HG14273-NY
CHMP7 cDNA ORF Clone, Human, C-Myc tag HG14273-CM
CHMP7 cDNA ORF Clone, Human, N-Myc tag HG14273-NM
CHMP7 qPCR Primer Pairs, Human HP102923
info info
添加购物车成功! 添加购物车失败!