CIRH1A/Cirhin cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

CIRH1A/Cirhin cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Description
Full length Clone DNA of Mouse cirrhosis, autosomal recessive 1A (human) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CIRH1A/Cirhin cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

Cirhin cDNA ORF Clone, Mouse; Naic cDNA ORF Clone, Mouse; Teg-292 cDNA ORF Clone, Mouse; Tex292 cDNA ORF Clone, Mouse

CIRH1A/Cirhin Background Information

Full Name
cirrhosis, autosomal recessive 1A (cirhin)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait