After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 CKB / Creatine kinase B type Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Mouse CKB cDNA 클론 제품 정보
Gene_bank_ref_id:NM_021273.4
cDNA 크기:1146bp
cDNA 설명:Full length Clone DNA of Mus musculus creatine kinase, brain.
유전자 동의어:Bck, Ck3, B-CK, Ck-3, Ckbb
:Mouse
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
쥐 CKB / Creatine kinase B type Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
연구배경

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

참고자료
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Cat No: MG51386-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".