쥐 CKM / CK-MM Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
데이터시트리뷰관련제품프로토콜
 CKM cDNA 클론 제품 정보
Gene_bank_ref_id:X03233.1
cDNA 크기:1146bp
cDNA 설명:Full length Clone DNA of Mus musculus creatine kinase, muscle.
유전자 동의어:MCK, Ckmm, M-CK
:Mouse
벡터:pCMV3-untagged
Plasmid:pCMV3-mCKM
제한 사이트:KpnI + XbaI(6.1kb+1.15kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 147C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CKM qPCR primers for gene expression analysis, MP201233 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

참고자료
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Cat No: MG51356-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    장바구니에 추가대량 주문 문의

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".