After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CKM / CK-MM Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Mouse CKM cDNA 클론 제품 정보
Gene_bank_ref_id:X03233.1
cDNA 크기:1146bp
cDNA 설명:Full length Clone DNA of Mus musculus creatine kinase, muscle.
유전자 동의어:MCK, Ckmm, M-CK
:Mouse
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

참고자료
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Cat No: MG51356-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".