After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CLDN11 / Claudin-11 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Mouse CLDN11 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008770.3
cDNA 크기:624bp
cDNA 설명:Full length Clone DNA of Mus musculus claudin 11 with N terminal Myc tag.
유전자 동의어:Osp, Otm, Claudin11, Claudin-11
:Mouse
벡터:pCMV3-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.

참고자료
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.
  • Size / Price
    Cat No: MG51441-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".