SCGF/CLEC11A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50334-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SCGF/CLEC11A Reagents

CRO Services

Product recommended


All SCGF/CLEC11A Reagents

SCGF/CLEC11A cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Mouse C-type lectin domain family 11, member a with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCGF/CLEC11A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

AW457320 cDNA ORF Clone, Mouse;Clecsf3 cDNA ORF Clone, Mouse;Scgf cDNA ORF Clone, Mouse

SCGF/CLEC11A Background Information

Full Name
C-type lectin domain family 11, member A

SCGF/CLEC11A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SCGF/CLEC11A cDNA ORF Clone in Cloning Vector, Rhesus CG90185-G
SCGF/CLEC11A cDNA ORF Clone, Rhesus, untagged CG90185-UT
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90185-ACG
SCGF/CLEC11A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90185-ACGLN
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90185-ACR
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90185-CF
SCGF/CLEC11A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90185-NF
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-His tag CG90185-CH
SCGF/CLEC11A cDNA ORF Clone, Rhesus, N-His tag CG90185-NH
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-HA tag CG90185-CY
SCGF/CLEC11A cDNA ORF Clone, Rhesus, N-HA tag CG90185-NY
SCGF/CLEC11A cDNA ORF Clone, Rhesus, C-Myc tag CG90185-CM
SCGF/CLEC11A cDNA ORF Clone, Rhesus, N-Myc tag CG90185-NM

SCGF/CLEC11A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SCGF/CLEC11A cDNA ORF Clone in Cloning Vector, Rat RG80254-G
SCGF/CLEC11A cDNA ORF Clone, Rat, untagged RG80254-UT
SCGF/CLEC11A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80254-ACG
SCGF/CLEC11A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80254-ACGLN
SCGF/CLEC11A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80254-ACR
SCGF/CLEC11A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80254-CF
SCGF/CLEC11A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80254-NF
SCGF/CLEC11A cDNA ORF Clone, Rat, C-His tag RG80254-CH
SCGF/CLEC11A cDNA ORF Clone, Rat, N-His tag RG80254-NH
SCGF/CLEC11A cDNA ORF Clone, Rat, C-HA tag RG80254-CY
SCGF/CLEC11A cDNA ORF Clone, Rat, N-HA tag RG80254-NY
SCGF/CLEC11A cDNA ORF Clone, Rat, C-Myc tag RG80254-CM
SCGF/CLEC11A cDNA ORF Clone, Rat, N-Myc tag RG80254-NM
SCGF/CLEC11A qPCR Primer Pairs, Rat RP300239

SCGF/CLEC11A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCGF/CLEC11A cDNA ORF Clone in Cloning Vector, Mouse MG50334-M
SCGF/CLEC11A cDNA ORF Clone, Mouse, untagged MG50334-UT
SCGF/CLEC11A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50334-ACG
SCGF/CLEC11A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50334-ACGLN
SCGF/CLEC11A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50334-ACR
SCGF/CLEC11A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50334-CF
SCGF/CLEC11A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50334-NF
SCGF/CLEC11A cDNA ORF Clone, Mouse, C-His tag MG50334-CH
SCGF/CLEC11A cDNA ORF Clone, Mouse, N-His tag MG50334-NH
SCGF/CLEC11A cDNA ORF Clone, Mouse, C-HA tag MG50334-CY
SCGF/CLEC11A cDNA ORF Clone, Mouse, N-HA tag MG50334-NY
SCGF/CLEC11A cDNA ORF Clone, Mouse, N-Myc tag MG50334-NM
SCGF/CLEC11A qPCR Primer Pairs, Mouse MP200357

SCGF/CLEC11A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCGF/CLEC11A cDNA ORF Clone, Human, untagged HG11883-UT
SCGF/CLEC11A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11883-ACGLN
SCGF/CLEC11A qPCR Primer Pairs, Human HP104657
info info
添加购物车成功! 添加购物车失败!