After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 CLL-1/MICL/CLEC12A Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse CLEC12A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_177686.3
cDNA 크기:804bp
cDNA 설명:Full length Clone DNA of Mus musculus C-type lectin domain family 12, member a with N terminal HA tag.
유전자 동의어:Micl, CLL-1, D230024O04, Clec12a
:Mouse
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. CLEC12A is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. C-type lectins are the most diverse and prevalent lectin family in immunity. Using a novel CLEC12A -specific monoclonal antibody, experiments had shown that human CLEC12A was expressed primarily on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. Although CLEC12A was highly N-glycosylated in primary cells, the level of glycosylation was found to vary between cell types. CLEC12A surface expression was down-regulated during inflammatory/activation conditions in vitro, as well as during an in vivo model of acute inflammation. This suggests that CLEC12A may be involved in the control of myeloid cell activation during inflammation.

참고자료
  • Lahoud MH, et al. (2009) The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses. J Immunol. 182(12): 7587-94.
  • Pyz E, et al. (2008) Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand. Eur J Immunol. 38(4): 1157-63.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36(8): 2159-69.
  • Size / Price
    Cat No: MG50558-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".