COLEC11 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50195-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COLEC11 Reagents
CRO Services
Product recommended

All COLEC11 Reagents
COLEC11 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
819 bp
Description
Full length Clone DNA of Mouse collectin sub-family member 11 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COLEC11 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1010001H16Rik cDNA ORF Clone, Mouse
COLEC11 Background Information
Full Name
collectin sub-family member 11

COLEC11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COLEC11 cDNA ORF Clone in Cloning Vector, Mouse MG50195-M
COLEC11 cDNA ORF Clone, Mouse, untagged MG50195-UT
COLEC11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50195-ACG
COLEC11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50195-ACGLN
COLEC11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50195-ACR
COLEC11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50195-CF
COLEC11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50195-NF
COLEC11 cDNA ORF Clone, Mouse, C-His tag MG50195-CH
COLEC11 cDNA ORF Clone, Mouse, N-His tag MG50195-NH
COLEC11 cDNA ORF Clone, Mouse, C-HA tag MG50195-CY
COLEC11 cDNA ORF Clone, Mouse, N-HA tag MG50195-NY
COLEC11 cDNA ORF Clone, Mouse, C-Myc tag MG50195-CM
COLEC11 qPCR Primer Pairs, Mouse MP200225

COLEC11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COLEC11 cDNA ORF Clone in Cloning Vector, Human HG12228-G
COLEC11 cDNA ORF Clone, Human, untagged HG12228-UT
COLEC11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12228-ACGLN
COLEC11 cDNA ORF Clone, Human, C-GFPSpark® tag HG12228-ACG
COLEC11 cDNA ORF Clone, Human, C-OFPSpark® tag HG12228-ACR
COLEC11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12228-CF
COLEC11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12228-NF
COLEC11 cDNA ORF Clone, Human, C-His tag HG12228-CH
COLEC11 cDNA ORF Clone, Human, N-His tag HG12228-NH
COLEC11 cDNA ORF Clone, Human, C-HA tag HG12228-CY
COLEC11 cDNA ORF Clone, Human, N-HA tag HG12228-NY
COLEC11 cDNA ORF Clone, Human, C-Myc tag HG12228-CM
COLEC11 cDNA ORF Clone, Human, N-Myc tag HG12228-NM
COLEC11 qPCR Primer Pairs, Human HP101857
info info
添加购物车成功! 添加购物车失败!