COX8B cDNA ORF Clone, Mouse, untagged

Cat: MG51351-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All COX8B Reagents

CRO Services

Product recommended


All COX8B Reagents

COX8B cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
213 bp
Description
Full length Clone DNA of Mouse cytochrome c oxidase subunit VIIIb.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX8B cDNA ORF Clone, Mouse, untagged Alternative Names

Cox8h cDNA ORF Clone, Mouse;CoxVIII-H cDNA ORF Clone, Mouse

COX8B Background Information

Full Name
cytochrome c oxidase subunit VIIIb

COX8B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COX8B cDNA ORF Clone in Cloning Vector, Rat RG80683-U
COX8B cDNA ORF Clone, Rat, untagged RG80683-UT
COX8B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80683-ACGLN
COX8B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80683-ACG
COX8B cDNA ORF Clone, Rat, N-GFPSpark® tag RG80683-ANG
COX8B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80683-ACR
COX8B cDNA ORF Clone, Rat, N-OFPSpark® tag RG80683-ANR
COX8B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80683-CF
COX8B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80683-NF
COX8B cDNA ORF Clone, Rat, C-His tag RG80683-CH
COX8B cDNA ORF Clone, Rat, N-His tag RG80683-NH
COX8B cDNA ORF Clone, Rat, C-HA tag RG80683-CY
COX8B cDNA ORF Clone, Rat, N-HA tag RG80683-NY
COX8B cDNA ORF Clone, Rat, C-Myc tag RG80683-CM
COX8B cDNA ORF Clone, Rat, N-Myc tag RG80683-NM
COX8B qPCR Primer Pairs, Rat RP300647

COX8B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX8B cDNA ORF Clone in Cloning Vector, Mouse MG51351-U
COX8B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51351-ACG
COX8B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51351-ACGLN
COX8B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51351-ANG
COX8B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51351-ACR
COX8B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51351-ANR
COX8B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51351-CF
COX8B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51351-NF
COX8B cDNA ORF Clone, Mouse, C-His tag MG51351-CH
COX8B cDNA ORF Clone, Mouse, N-His tag MG51351-NH
COX8B cDNA ORF Clone, Mouse, C-HA tag MG51351-CY
COX8B cDNA ORF Clone, Mouse, N-HA tag MG51351-NY
COX8B cDNA ORF Clone, Mouse, C-Myc tag MG51351-CM
COX8B cDNA ORF Clone, Mouse, N-Myc tag MG51351-NM
COX8B qPCR Primer Pairs, Mouse MP201228
info info
添加购物车成功! 添加购物车失败!