After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Mouse CPA1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_025350.3
cDNA 크기:1260bp
cDNA 설명:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
유전자 동의어:Cpa, 0910001L12Rik, Cpa1
:Mouse
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

참고자료
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Cat No: MG50448-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".