After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CTLA-4/CD152 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse CTLA4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009843.3
cDNA 크기:654bp
cDNA 설명:Full length Clone DNA of Mus musculus cytotoxic T-lymphocyte-associated protein 4 with C terminal HA tag.
유전자 동의어:Cd152, Ly-56, Ctla-4, Ctla4
:Mouse
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

참고자료
  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • Size / Price
    Cat No: MG50503-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".