Cathepsin A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50348-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cathepsin A Reagents
CRO Services
Product recommended

All Cathepsin A Reagents
Cathepsin A cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Mouse cathepsin A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AU019505 cDNA ORF Clone, Mouse;PPCA cDNA ORF Clone, Mouse;Ppgb cDNA ORF Clone, Mouse
Cathepsin A Background Information

Lysosomal carboxypeptidase, cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with beta-galactosidase (GAL) and sialidase Neu1, where it activates Neu1 and protects GAL and Neu1 against the rapid proteolytic degradation. Cathepsin A is a multicatalytic enzyme with deamidase and esterase in addition to carboxypeptidase activities. It was recently identified in human platelets as deamidase. In vitro, it hydrolyzes a variety of bioactive peptide hormones including tachykinins, suggesting that extralysosomal cathepsin A plays a role in regulation of bioactive peptide functions. It is a member of the alpha/beta hydrolase fold family and has been suggested to share a common ancestral relationship with other alpha/beta hydrolase fold enzymes, such as cholinesterases. Cathepsin A defects are linked to multiple forms of Galactosialidosis with a combined secondary deficiency of beta-galactosidase and neuraminidase. Cathepsin A is a key molecule in the onset of galactosialidosis and also highlight the therapeutic acts in vivo as an endothelin-1-inactivating enzyme and strongly confirm a crucial role of this enzyme in effective elastic fiber formation.

Full Name
cathepsin A
References
  • Hiraiwa M. (1999) Cathepsin A/protective protein: an unusual lysosomal multifunctional protein. Cell Mol Life Sci. 56(11-12): 894-907.
  • Yoshida T, et al. (2006) Comparative analysis of binding energy of chymostatin with human cathepsin A and its homologous proteins by molecular orbital calculation. J Chem Inf Model. 46(5): 2093-103.
  • Seyrantepe V, et al. (2008) Enzymatic activity of lysosomal carboxypeptidase (cathepsin) A is required for proper elastic fiber formation and inactivation of endothelin-1. Circulation. 117(15): 1973-81.
  • Cathepsin A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin A cDNA ORF Clone in Cloning Vector, Rat RG87436-U
    Cathepsin A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87436-ACGLN

    Cathepsin A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin A cDNA ORF Clone in Cloning Vector, Mouse MG50348-M
    Cathepsin A cDNA ORF Clone, Mouse, untagged MG50348-UT
    Cathepsin A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50348-ACG
    Cathepsin A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50348-ACGLN
    Cathepsin A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50348-ACR
    Cathepsin A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50348-CF
    Cathepsin A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50348-NF
    Cathepsin A cDNA ORF Clone, Mouse, C-His tag MG50348-CH
    Cathepsin A cDNA ORF Clone, Mouse, N-His tag MG50348-NH
    Cathepsin A cDNA ORF Clone, Mouse, C-HA tag MG50348-CY
    Cathepsin A cDNA ORF Clone, Mouse, N-HA tag MG50348-NY
    Cathepsin A cDNA ORF Clone, Mouse, N-Myc tag MG50348-NM
    Cathepsin A qPCR Primer Pairs, Mouse MP200067

    Cathepsin A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin A cDNA ORF Clone in Cloning Vector, Human HG10482-U
    Cathepsin A cDNA ORF Clone, Human, untagged HG10482-UT
    Cathepsin A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10482-ACGLN
    Cathepsin A cDNA ORF Clone, Human, C-GFPSpark® tag HG10482-ACG
    Cathepsin A cDNA ORF Clone, Human, C-OFPSpark® tag HG10482-ACR
    Cathepsin A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10482-CF
    Cathepsin A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10482-NF
    Cathepsin A cDNA ORF Clone, Human, C-His tag HG10482-CH
    Cathepsin A cDNA ORF Clone, Human, N-His tag HG10482-NH
    Cathepsin A cDNA ORF Clone, Human, C-HA tag HG10482-CY
    Cathepsin A cDNA ORF Clone, Human, N-HA tag HG10482-NY
    Cathepsin A cDNA ORF Clone, Human, C-Myc tag HG10482-CM
    Cathepsin A cDNA ORF Clone, Human, N-Myc tag HG10482-NM
    Cathepsin A qPCR Primer Pairs, Human HP100504
    info info
    添加购物车成功! 添加购物车失败!