DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52920-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DDRGK1 Reagents

CRO Services

Product recommended


All DDRGK1 Reagents

DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
948 bp
Description
Full length Clone DNA of Mouse DDRGK domain containing 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

1110001I20Rik cDNA ORF Clone, Mouse;2600009E05Rik cDNA ORF Clone, Mouse;AI326138 cDNA ORF Clone, Mouse;Ufbp1 cDNA ORF Clone, Mouse

DDRGK1 Background Information

Full Name
DDRGK domain containing 1

DDRGK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDRGK1 cDNA ORF Clone in Cloning Vector, Mouse MG52920-G
DDRGK1 cDNA ORF Clone, Mouse, untagged MG52920-UT
DDRGK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52920-ACGLN
DDRGK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52920-ACG
DDRGK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52920-ACR
DDRGK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52920-CF
DDRGK1 cDNA ORF Clone, Mouse, C-His tag MG52920-CH
DDRGK1 cDNA ORF Clone, Mouse, N-His tag MG52920-NH
DDRGK1 cDNA ORF Clone, Mouse, C-HA tag MG52920-CY
DDRGK1 cDNA ORF Clone, Mouse, N-HA tag MG52920-NY
DDRGK1 cDNA ORF Clone, Mouse, C-Myc tag MG52920-CM
DDRGK1 cDNA ORF Clone, Mouse, N-Myc tag MG52920-NM

DDRGK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDRGK1 cDNA ORF Clone in Cloning Vector, Human HG13287-G
DDRGK1 cDNA ORF Clone, Human, untagged HG13287-UT
DDRGK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13287-ACGLN
DDRGK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13287-ACG
DDRGK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13287-ACR
DDRGK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13287-CF
DDRGK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13287-NF
DDRGK1 cDNA ORF Clone, Human, C-His tag HG13287-CH
DDRGK1 cDNA ORF Clone, Human, N-His tag HG13287-NH
DDRGK1 cDNA ORF Clone, Human, C-HA tag HG13287-CY
DDRGK1 cDNA ORF Clone, Human, N-HA tag HG13287-NY
DDRGK1 cDNA ORF Clone, Human, C-Myc tag HG13287-CM
DDRGK1 cDNA ORF Clone, Human, N-Myc tag HG13287-NM
DDRGK1 qPCR Primer Pairs, Human HP101995
info info
添加购物车成功! 添加购物车失败!