DDX56 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51656-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DDX56 Reagents
CRO Services
Product recommended

All DDX56 Reagents
DDX56 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX56 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2600001H07Rik cDNA ORF Clone, Mouse;D11Ertd619e cDNA ORF Clone, Mouse;Noh61 cDNA ORF Clone, Mouse
DDX56 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box helicase 56

DDX56 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DDX56 cDNA ORF Clone in Cloning Vector, Rat RG87931-U
DDX56 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87931-ACGLN

DDX56 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX56 cDNA ORF Clone in Cloning Vector, Mouse MG51656-G
DDX56 cDNA ORF Clone, Mouse, untagged MG51656-UT
DDX56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51656-ACGLN
DDX56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51656-ACG
DDX56 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51656-ANG
DDX56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51656-ACR
DDX56 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51656-ANR
DDX56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51656-CF
DDX56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51656-NF
DDX56 cDNA ORF Clone, Mouse, C-His tag MG51656-CH
DDX56 cDNA ORF Clone, Mouse, N-His tag MG51656-NH
DDX56 cDNA ORF Clone, Mouse, C-HA tag MG51656-CY
DDX56 cDNA ORF Clone, Mouse, N-HA tag MG51656-NY
DDX56 cDNA ORF Clone, Mouse, N-Myc tag MG51656-NM
DDX56 qPCR Primer Pairs, Mouse MP201529

DDX56 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX56 cDNA ORF Clone in Cloning Vector, Human HG16794-U
DDX56 cDNA ORF Clone, Human, untagged HG16794-UT
DDX56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16794-ACGLN
DDX56 cDNA ORF Clone, Human, C-GFPSpark® tag HG16794-ACG
DDX56 cDNA ORF Clone, Human, N-GFPSpark® tag HG16794-ANG
DDX56 cDNA ORF Clone, Human, C-OFPSpark® tag HG16794-ACR
DDX56 cDNA ORF Clone, Human, N-OFPSpark® tag HG16794-ANR
DDX56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16794-CF
DDX56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16794-NF
DDX56 cDNA ORF Clone, Human, C-His tag HG16794-CH
DDX56 cDNA ORF Clone, Human, N-His tag HG16794-NH
DDX56 cDNA ORF Clone, Human, C-HA tag HG16794-CY
DDX56 cDNA ORF Clone, Human, N-HA tag HG16794-NY
DDX56 cDNA ORF Clone, Human, C-Myc tag HG16794-CM
DDX56 cDNA ORF Clone, Human, N-Myc tag HG16794-NM
info info
添加购物车成功! 添加购物车失败!