EIF4A3 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51605-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF4A3 Reagents
CRO Services
Product recommended

All EIF4A3 Reagents
EIF4A3 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 4A3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF4A3 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2400003O03Rik cDNA ORF Clone, Mouse;Ddx48 cDNA ORF Clone, Mouse;eIF4A-III cDNA ORF Clone, Mouse;mKIAA0111 cDNA ORF Clone, Mouse
EIF4A3 Background Information
Full Name
eukaryotic translation initiation factor 4A3

EIF4A3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF4A3 cDNA ORF Clone in Cloning Vector, Rat RG85998-U
EIF4A3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85998-ACGLN

EIF4A3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF4A3 cDNA ORF Clone in Cloning Vector, Mouse MG51605-U
EIF4A3 cDNA ORF Clone, Mouse, untagged MG51605-UT
EIF4A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51605-ACGLN
EIF4A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51605-ACG
EIF4A3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51605-ANG
EIF4A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51605-ACR
EIF4A3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51605-ANR
EIF4A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51605-CF
EIF4A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51605-NF
EIF4A3 cDNA ORF Clone, Mouse, C-His tag MG51605-CH
EIF4A3 cDNA ORF Clone, Mouse, N-His tag MG51605-NH
EIF4A3 cDNA ORF Clone, Mouse, C-HA tag MG51605-CY
EIF4A3 cDNA ORF Clone, Mouse, N-HA tag MG51605-NY
EIF4A3 cDNA ORF Clone, Mouse, N-Myc tag MG51605-NM
EIF4A3 qPCR Primer Pairs, Mouse MP201272

EIF4A3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF4A3 cDNA ORF Clone in Cloning Vector, Human HG14195-G
EIF4A3 cDNA ORF Clone, Human, untagged HG14195-UT
EIF4A3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14195-ACG
EIF4A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14195-ACGLN
EIF4A3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14195-ANG
EIF4A3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14195-ACR
EIF4A3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14195-ANR
EIF4A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14195-CF
EIF4A3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14195-NF
EIF4A3 cDNA ORF Clone, Human, C-His tag HG14195-CH
EIF4A3 cDNA ORF Clone, Human, N-His tag HG14195-NH
EIF4A3 cDNA ORF Clone, Human, C-HA tag HG14195-CY
EIF4A3 cDNA ORF Clone, Human, N-HA tag HG14195-NY
EIF4A3 cDNA ORF Clone, Human, C-Myc tag HG14195-CM
EIF4A3 cDNA ORF Clone, Human, N-Myc tag HG14195-NM
EIF4A3 qPCR Primer Pairs, Human HP102846
info info
添加购物车成功! 添加购物车失败!