After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 4E-BP1/EIF4EBP1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse EIF4EBP1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_007918.3
cDNA 크기:354bp
cDNA 설명:Full length Clone DNA of Mus musculus Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal His tag.
유전자 동의어:4e-bp1, PHAS-I
:Mouse
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

참고자료
  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    Cat No: MG50739-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".