After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 CD39 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Mouse ENTPD1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009848.3
cDNA 크기:1533bp
cDNA 설명:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 1 with C terminal Flag tag.
유전자 동의어:Cd39, AA408691, NTPDase-1, 2610206B08Rik, Entpd1
:Mouse
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on activated lymphoid cells and can also be detected in endothelial tissues. The vascular isoform and the placental isoform II are present in both placenta and umbilical vein, whereas placental isoform I is present in placenta only. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. It is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 transgenic mice exhibit impaired platelet aggregation, prolonged bleeding times, and resistance to systemic thromboembolism. There is a correlation between ATP hydrolysis and triglycerides in patients with chronic heart disease, suggesting a relationship between ATP diphosphohydrolase and thrombogenesis. In the nervous system, CD39 could hydrolyze ATP and other nucleotides to regulate purinergic neurotransmission.

참고자료
  • Kunzli BM, et al. (2011) Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 2011 56 (5): 1393-403.
  • Clayton A, et al. (2011) Cancer exosomes express CD39 and CD73, which suppress T cells through adenosine production. J Immunol. 187 (2): 676-83.
  • Loza MJ, et al. (2011) T-cell specific defect in expression of the NTPDase CD39 as a biomarker for lupus. Cell Immunol. 271 (1): 110-7.
  • Size / Price
    Cat No: MG50398-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".