ESD cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52754-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ESD Reagents
CRO Services
Product recommended

All ESD Reagents
ESD cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Mouse esterase D/formylglutathione hydrolase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ESD cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Es-10 cDNA ORF Clone, Mouse;Es10 cDNA ORF Clone, Mouse;FGH cDNA ORF Clone, Mouse;sid478 cDNA ORF Clone, Mouse
ESD Background Information

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

Full Name
esterase D
References
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • ESD cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ESD cDNA ORF Clone in Cloning Vector, Mouse MG52754-G
    ESD cDNA ORF Clone, Mouse, untagged MG52754-UT
    ESD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52754-ACGLN
    ESD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52754-ACG
    ESD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52754-ANG
    ESD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52754-ACR
    ESD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52754-ANR
    ESD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52754-CF
    ESD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52754-NF
    ESD cDNA ORF Clone, Mouse, C-His tag MG52754-CH
    ESD cDNA ORF Clone, Mouse, N-His tag MG52754-NH
    ESD cDNA ORF Clone, Mouse, C-HA tag MG52754-CY
    ESD cDNA ORF Clone, Mouse, N-HA tag MG52754-NY
    ESD cDNA ORF Clone, Mouse, N-Myc tag MG52754-NM

    ESD cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ESD cDNA ORF Clone in Cloning Vector, Human HG14252-G
    ESD cDNA ORF Clone, Human, untagged HG14252-UT
    ESD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14252-ACGLN
    ESD cDNA ORF Clone, Human, C-GFPSpark® tag HG14252-ACG
    ESD cDNA ORF Clone, Human, N-GFPSpark® tag HG14252-ANG
    ESD cDNA ORF Clone, Human, C-OFPSpark® tag HG14252-ACR
    ESD cDNA ORF Clone, Human, N-OFPSpark® tag HG14252-ANR
    ESD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14252-CF
    ESD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14252-NF
    ESD cDNA ORF Clone, Human, C-His tag HG14252-CH
    ESD cDNA ORF Clone, Human, N-His tag HG14252-NH
    ESD cDNA ORF Clone, Human, C-HA tag HG14252-CY
    ESD cDNA ORF Clone, Human, N-HA tag HG14252-NY
    ESD cDNA ORF Clone, Human, C-Myc tag HG14252-CM
    ESD cDNA ORF Clone, Human, N-Myc tag HG14252-NM
    ESD qPCR Primer Pairs, Human HP102902
    info info
    添加购物车成功! 添加购物车失败!