FASTK cDNA ORF Clone, Mouse, N-His tag

Cat: MG50891-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FASTK Reagents

CRO Services

Product recommended


All FASTK Reagents

FASTK cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1638 bp
Description
Full length Clone DNA of Mouse Fas-activated serine/threonine kinase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FASTK cDNA ORF Clone, Mouse, N-His tag Alternative Names

0610011K02Rik cDNA ORF Clone, Mouse;610011K02Rik cDNA ORF Clone, Mouse

FASTK Background Information

Full Name
Fas-activated serine/threonine kinase

FASTK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FASTK cDNA ORF Clone in Cloning Vector, Mouse MG50891-G
FASTK cDNA ORF Clone, Mouse, untagged MG50891-UT
FASTK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50891-ACG
FASTK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50891-ACGLN
FASTK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50891-ANG
FASTK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50891-ACR
FASTK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50891-ANR
FASTK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50891-CF
FASTK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50891-NF
FASTK cDNA ORF Clone, Mouse, C-His tag MG50891-CH
FASTK cDNA ORF Clone, Mouse, C-HA tag MG50891-CY
FASTK cDNA ORF Clone, Mouse, N-HA tag MG50891-NY
FASTK cDNA ORF Clone, Mouse, C-Myc tag MG50891-CM
FASTK cDNA ORF Clone, Mouse, N-Myc tag MG50891-NM
FASTK qPCR Primer Pairs, Mouse MP200862

FASTK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FASTK cDNA ORF Clone in Cloning Vector, Human HG10737-M
FASTK cDNA ORF Clone, Human, untagged HG10737-UT
FASTK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10737-ACGLN
FASTK cDNA ORF Clone, Human, C-GFPSpark® tag HG10737-ACG
FASTK cDNA ORF Clone, Human, N-GFPSpark® tag HG10737-ANG
FASTK cDNA ORF Clone, Human, C-OFPSpark® tag HG10737-ACR
FASTK cDNA ORF Clone, Human, N-OFPSpark® tag HG10737-ANR
FASTK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10737-CF
FASTK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10737-NF
FASTK cDNA ORF Clone, Human, C-His tag HG10737-CH
FASTK cDNA ORF Clone, Human, N-His tag HG10737-NH
FASTK cDNA ORF Clone, Human, C-HA tag HG10737-CY
FASTK cDNA ORF Clone, Human, N-HA tag HG10737-NY
FASTK cDNA ORF Clone, Human, C-Myc tag HG10737-CM
FASTK cDNA ORF Clone, Human, N-Myc tag HG10737-NM
FASTK qPCR Primer Pairs, Human HP100673
info info
添加购物车成功! 添加购物车失败!