After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 FGF10 / KGF2 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Mouse FGF10 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008002.3
cDNA 크기:609bp
cDNA 설명:Full length Clone DNA of Mus musculus fibroblast growth factor 10 with N terminal Myc tag.
유전자 동의어:FGF-10, BB213776, Fgf10
:Mouse
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.

참고자료
  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.
  • Size / Price
    Cat No: MG50196-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".