FGFBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50449-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FGFBP1 Reagents

CRO Services

Product recommended


All FGFBP1 Reagents

FGFBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
756 bp
Description
Full length Clone DNA of Mouse fibroblast growth factor binding protein 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGFBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

FGF-BP cDNA ORF Clone, Mouse;FGF-BP1 cDNA ORF Clone, Mouse;FGFBP-1 cDNA ORF Clone, Mouse

FGFBP1 Background Information

Full Name
fibroblast growth factor binding protein 1

FGFBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FGFBP1 cDNA ORF Clone in Cloning Vector, Rat RG80026-M
FGFBP1 cDNA ORF Clone, Rat, untagged RG80026-UT
FGFBP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80026-ACG
FGFBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80026-ACGLN
FGFBP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80026-ACR
FGFBP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80026-CF
FGFBP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80026-NF
FGFBP1 cDNA ORF Clone, Rat, C-His tag RG80026-CH
FGFBP1 cDNA ORF Clone, Rat, N-His tag RG80026-NH
FGFBP1 cDNA ORF Clone, Rat, C-HA tag RG80026-CY
FGFBP1 cDNA ORF Clone, Rat, N-HA tag RG80026-NY
FGFBP1 cDNA ORF Clone, Rat, C-Myc tag RG80026-CM
FGFBP1 cDNA ORF Clone, Rat, N-Myc tag RG80026-NM
FGFBP1 qPCR Primer Pairs, Rat RP300025

FGFBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FGFBP1 cDNA ORF Clone in Cloning Vector, Mouse MG50449-M
FGFBP1 cDNA ORF Clone, Mouse, untagged MG50449-UT
FGFBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50449-ACG
FGFBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50449-ACGLN
FGFBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50449-ACR
FGFBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50449-CF
FGFBP1 cDNA ORF Clone, Mouse, C-His tag MG50449-CH
FGFBP1 cDNA ORF Clone, Mouse, N-His tag MG50449-NH
FGFBP1 cDNA ORF Clone, Mouse, C-HA tag MG50449-CY
FGFBP1 cDNA ORF Clone, Mouse, N-HA tag MG50449-NY
FGFBP1 cDNA ORF Clone, Mouse, C-Myc tag MG50449-CM
FGFBP1 cDNA ORF Clone, Mouse, N-Myc tag MG50449-NM
FGFBP1 qPCR Primer Pairs, Mouse MP200458

FGFBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FGFBP1 cDNA ORF Clone in Cloning Vector, Human HG11344-M
FGFBP1 cDNA ORF Clone, Human, untagged HG11344-UT
FGFBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11344-ACG
FGFBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11344-ACGLN
FGFBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11344-ACR
FGFBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11344-CF
FGFBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11344-NF
FGFBP1 cDNA ORF Clone, Human, C-His tag HG11344-CH
FGFBP1 cDNA ORF Clone, Human, N-His tag HG11344-NH
FGFBP1 cDNA ORF Clone, Human, C-HA tag HG11344-CY
FGFBP1 cDNA ORF Clone, Human, N-HA tag HG11344-NY
FGFBP1 cDNA ORF Clone, Human, C-Myc tag HG11344-CM
FGFBP1 cDNA ORF Clone, Human, N-Myc tag HG11344-NM
FGFBP1 qPCR Primer Pairs, Human HP101229
info info
添加购物车成功! 添加购物车失败!