Flt3 Ligand cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51113-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Flt3 Ligand Reagents
CRO Services
Product recommended

All Flt3 Ligand Reagents
Flt3 Ligand cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
699 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse FMS-like tyrosine kinase 3 ligand with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI (6kb + 0.74kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Flt3 Ligand cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Flt3 Ligand cDNA ORF Clone, Mouse, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Flt3 Ligand cDNA ORF Clone, Mouse, C-HA tag Alternative Names
FLT3L cDNA ORF Clone, Mouse
Flt3 Ligand Background Information

FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases the number of immune cells by activating the hematopoietic progenitors. In vivo, FLT3L also induces the mobilization of the hematopoietic progenitors and stem cells. This may help the system to kill cancer cells. Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3L controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 -positive classical DCs and their CD103 -positive tissue counterparts.

Full Name
fms related tyrosine kinase 3 ligand
References
  • Hannum C, et al. (1994) Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368 (6472): 643-8.
  • Lyman SD, et al. (1995) Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs. Oncogene 10 (1): 149-57.
  • Lyman SD, et al. (1994) Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75 (6): 1157-67.
  • Flt3 Ligand cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Flt3 Ligand cDNA ORF Clone in Cloning Vector, Mouse MG51113-G
    Flt3 Ligand cDNA ORF Clone, Mouse, untagged MG51113-UT
    Flt3 Ligand Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51113-ACGLN
    Flt3 Ligand cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51113-ACG
    Flt3 Ligand cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51113-ACR
    Flt3 Ligand cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51113-CF
    Flt3 Ligand cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51113-NF
    Flt3 Ligand cDNA ORF Clone, Mouse, C-His tag MG51113-CH
    Flt3 Ligand cDNA ORF Clone, Mouse, N-His tag MG51113-NH
    Flt3 Ligand cDNA ORF Clone, Mouse, N-HA tag MG51113-NY
    Flt3 Ligand cDNA ORF Clone, Mouse, C-Myc tag MG51113-CM
    Flt3 Ligand cDNA ORF Clone, Mouse, N-Myc tag MG51113-NM
    Flt3 Ligand qPCR Primer Pairs, Mouse MP201064

    Flt3 Ligand cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Flt3 Ligand cDNA ORF Clone in Cloning Vector, Human HG10315-G
    Flt3 Ligand cDNA ORF Clone, Human, untagged HG10315-UT
    Flt3 Ligand cDNA ORF Clone, Human, C-GFPSpark® tag HG10315-ACG
    Flt3 Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10315-ACGLN
    Flt3 Ligand cDNA ORF Clone, Human, C-OFPSpark® tag HG10315-ACR
    Flt3 Ligand cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10315-CF
    Flt3 Ligand cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10315-NF
    Flt3 Ligand cDNA ORF Clone, Human, C-His tag HG10315-CH
    Flt3 Ligand cDNA ORF Clone, Human, N-His tag HG10315-NH
    Flt3 Ligand cDNA ORF Clone, Human, C-HA tag HG10315-CY
    Flt3 Ligand cDNA ORF Clone, Human, N-HA tag HG10315-NY
    Flt3 Ligand cDNA ORF Clone, Human, C-Myc tag HG10315-CM
    Flt3 Ligand cDNA ORF Clone, Human, N-Myc tag HG10315-NM
    Flt3 Ligand qPCR Primer Pairs, Human HP100357
    info info
    添加购物车成功! 添加购物车失败!