After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse GALE cDNA 클론 제품 정보
Gene_bank_ref_id:NM_178389.3
cDNA 크기:1044bp
cDNA 설명:Full length Clone DNA of Mus musculus galactose-4-epimerase, UDP with C terminal HA tag.
유전자 동의어:AI323962, 2310002A12Rik
:Mouse
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG51770-ACG265262
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG51770-ACR265262
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그MG51770-ANG265262
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그MG51770-ANR265262
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-Flag 태그MG51770-CF229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-His 태그MG51770-CH229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-Myc 태그MG51770-CM229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-HA 태그MG51770-CY229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone in cloning vectorMG51770-G88421
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-Flag 태그MG51770-NF229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-His 태그MG51770-NH229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-Myc 태그MG51770-NM229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, N-HA 태그MG51770-NY229893
쥐 UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmidMG51770-UT229893
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

참고자료
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    Cat No: MG51770-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".