GDAP2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51451-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GDAP2 Reagents
CRO Services
Product recommended

All GDAP2 Reagents
GDAP2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Description
Full length Clone DNA of Mouse ganglioside-induced differentiation-associated-protein 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDAP2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
C77050 cDNA ORF Clone, Mouse;D3Ertd801e cDNA ORF Clone, Mouse
GDAP2 Background Information
Full Name
ganglioside induced differentiation associated protein 2

GDAP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDAP2 cDNA ORF Clone in Cloning Vector, Mouse MG51451-G
GDAP2 cDNA ORF Clone, Mouse, untagged MG51451-UT
GDAP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51451-ACG
GDAP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51451-ACGLN
GDAP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51451-ANG
GDAP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51451-ACR
GDAP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51451-ANR
GDAP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51451-CF
GDAP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51451-NF
GDAP2 cDNA ORF Clone, Mouse, C-His tag MG51451-CH
GDAP2 cDNA ORF Clone, Mouse, N-His tag MG51451-NH
GDAP2 cDNA ORF Clone, Mouse, C-HA tag MG51451-CY
GDAP2 cDNA ORF Clone, Mouse, N-HA tag MG51451-NY
GDAP2 cDNA ORF Clone, Mouse, C-Myc tag MG51451-CM
GDAP2 qPCR Primer Pairs, Mouse MP201335

GDAP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDAP2 cDNA ORF Clone in Cloning Vector, Human HG16906-U
GDAP2 cDNA ORF Clone, Human, untagged HG16906-UT
GDAP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16906-ACG
GDAP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16906-ACGLN
GDAP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16906-ANG
GDAP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16906-ACR
GDAP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16906-ANR
GDAP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16906-CF
GDAP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16906-NF
GDAP2 cDNA ORF Clone, Human, C-His tag HG16906-CH
GDAP2 cDNA ORF Clone, Human, N-His tag HG16906-NH
GDAP2 cDNA ORF Clone, Human, C-HA tag HG16906-CY
GDAP2 cDNA ORF Clone, Human, N-HA tag HG16906-NY
GDAP2 cDNA ORF Clone, Human, C-Myc tag HG16906-CM
GDAP2 cDNA ORF Clone, Human, N-Myc tag HG16906-NM
info info
添加购物车成功! 添加购物车失败!