Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50742-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Glypican 6/GPC6 Reagents
CRO Services
Product recommended

All Glypican 6/GPC6 Reagents
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1698 bp
Description
Full length Clone DNA of Mouse glypican 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glypican 6/GPC6 Background Information
Full Name
glypican 6

Glypican 6/GPC6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Glypican 6/GPC6 cDNA ORF Clone in Cloning Vector, Mouse MG50742-M
Glypican 6/GPC6 cDNA ORF Clone, Mouse, untagged MG50742-UT
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50742-ACG
Glypican 6/GPC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50742-ACGLN
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50742-ACR
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50742-CF
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50742-NF
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-His tag MG50742-CH
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-HA tag MG50742-CY
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-HA tag MG50742-NY
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-Myc tag MG50742-CM
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-Myc tag MG50742-NM
Glypican 6/GPC6 qPCR Primer Pairs, Mouse MP200717

Glypican 6/GPC6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Glypican 6/GPC6 cDNA ORF Clone in Cloning Vector, Human HG10102-M
Glypican 6/GPC6 cDNA ORF Clone, Human, untagged HG10102-UT
Glypican 6/GPC6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10102-ACGLN
Glypican 6/GPC6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10102-ACG
Glypican 6/GPC6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10102-ACR
Glypican 6/GPC6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10102-CF
Glypican 6/GPC6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10102-NF
Glypican 6/GPC6 cDNA ORF Clone, Human, C-His tag HG10102-CH
Glypican 6/GPC6 cDNA ORF Clone, Human, N-His tag HG10102-NH
Glypican 6/GPC6 cDNA ORF Clone, Human, C-HA tag HG10102-CY
Glypican 6/GPC6 cDNA ORF Clone, Human, N-HA tag HG10102-NY
Glypican 6/GPC6 cDNA ORF Clone, Human, C-Myc tag HG10102-CM
Glypican 6/GPC6 cDNA ORF Clone, Human, N-Myc tag HG10102-NM
Glypican 6/GPC6 qPCR Primer Pairs, Human HP100182
info info
添加购物车成功! 添加购物车失败!