HERPUD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52202-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HERPUD1 Reagents

CRO Services

Product recommended


All HERPUD1 Reagents

HERPUD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Mouse homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HERPUD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

Herp cDNA ORF Clone, Mouse;Mifl cDNA ORF Clone, Mouse;SUP cDNA ORF Clone, Mouse

HERPUD1 Background Information

Full Name
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1

HERPUD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HERPUD1 cDNA ORF Clone in Cloning Vector, Rat RG84863-U
HERPUD1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84863-ACGLN

HERPUD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HERPUD1 cDNA ORF Clone in Cloning Vector, Mouse MG52202-U
HERPUD1 cDNA ORF Clone, Mouse, untagged MG52202-UT
HERPUD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52202-ACGLN
HERPUD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52202-ACG
HERPUD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52202-ACR
HERPUD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52202-NF
HERPUD1 cDNA ORF Clone, Mouse, C-His tag MG52202-CH
HERPUD1 cDNA ORF Clone, Mouse, N-His tag MG52202-NH
HERPUD1 cDNA ORF Clone, Mouse, C-HA tag MG52202-CY
HERPUD1 cDNA ORF Clone, Mouse, N-HA tag MG52202-NY
HERPUD1 cDNA ORF Clone, Mouse, C-Myc tag MG52202-CM
HERPUD1 cDNA ORF Clone, Mouse, N-Myc tag MG52202-NM
HERPUD1 qPCR Primer Pairs, Mouse MP202075

HERPUD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HERPUD1 cDNA ORF Clone in Cloning Vector, Human HG12992-U
HERPUD1 cDNA ORF Clone, Human, untagged HG12992-UT
HERPUD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12992-ACGLN
HERPUD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12992-ACG
HERPUD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12992-ACR
HERPUD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12992-CF
HERPUD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12992-NF
HERPUD1 cDNA ORF Clone, Human, C-His tag HG12992-CH
HERPUD1 cDNA ORF Clone, Human, N-His tag HG12992-NH
HERPUD1 cDNA ORF Clone, Human, C-HA tag HG12992-CY
HERPUD1 cDNA ORF Clone, Human, N-HA tag HG12992-NY
HERPUD1 cDNA ORF Clone, Human, C-Myc tag HG12992-CM
HERPUD1 cDNA ORF Clone, Human, N-Myc tag HG12992-NM
info info
添加购物车成功! 添加购物车失败!