쥐 HID1/C17orf28 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
 HID1 cDNA 클론 제품 정보
Gene_bank_ref_id:AK044395.1
cDNA 크기:2364bp
cDNA 설명:Full length Clone DNA of Mus musculus HID1 domain containing.
유전자 동의어:C630004H02Rik
:Mouse
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HID1 qPCR primers for gene expression analysis, MP201261 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: MG51388-UT
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".