HMOX1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52753-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HMOX1 Reagents

CRO Services

Product recommended


All HMOX1 Reagents

HMOX1 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Mouse heme oxygenase (decycling) 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMOX1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

D8Wsu38e cDNA ORF Clone, Mouse;Hemox cDNA ORF Clone, Mouse;Hmox cDNA ORF Clone, Mouse;HO-1 cDNA ORF Clone, Mouse;HO1 cDNA ORF Clone, Mouse;Hsp32 cDNA ORF Clone, Mouse

HMOX1 Background Information

Full Name
heme oxygenase 1

HMOX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMOX1 cDNA ORF Clone in Cloning Vector, Mouse MG52753-G
HMOX1 cDNA ORF Clone, Mouse, untagged MG52753-UT
HMOX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52753-ACGLN
HMOX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52753-ACG
HMOX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52753-ANG
HMOX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52753-ACR
HMOX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52753-ANR
HMOX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52753-CF
HMOX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52753-NF
HMOX1 cDNA ORF Clone, Mouse, C-His tag MG52753-CH
HMOX1 cDNA ORF Clone, Mouse, N-His tag MG52753-NH
HMOX1 cDNA ORF Clone, Mouse, C-HA tag MG52753-CY
HMOX1 cDNA ORF Clone, Mouse, N-HA tag MG52753-NY
HMOX1 cDNA ORF Clone, Mouse, N-Myc tag MG52753-NM

HMOX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMOX1 cDNA ORF Clone in Cloning Vector, Human HG16608-U
HMOX1 cDNA ORF Clone, Human, untagged HG16608-UT
HMOX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16608-ACGLN
HMOX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16608-ACG
HMOX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16608-ANG
HMOX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16608-ACR
HMOX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16608-ANR
HMOX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16608-CF
HMOX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16608-NF
HMOX1 cDNA ORF Clone, Human, C-His tag HG16608-CH
HMOX1 cDNA ORF Clone, Human, N-His tag HG16608-NH
HMOX1 cDNA ORF Clone, Human, C-HA tag HG16608-CY
HMOX1 cDNA ORF Clone, Human, N-HA tag HG16608-NY
HMOX1 cDNA ORF Clone, Human, C-Myc tag HG16608-CM
HMOX1 cDNA ORF Clone, Human, N-Myc tag HG16608-NM
info info
添加购物车成功! 添加购物车失败!