HSD17B7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51644-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HSD17B7 Reagents

CRO Services

Product recommended


All HSD17B7 Reagents

HSD17B7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse hydroxysteroid (17-beta) dehydrogenase 7 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD17B7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

AI266814 cDNA ORF Clone, Mouse;ERG27 cDNA ORF Clone, Mouse

HSD17B7 Background Information

Full Name
hydroxysteroid (17-beta) dehydrogenase 7

HSD17B7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSD17B7 cDNA ORF Clone in Cloning Vector, Mouse MG51644-U
HSD17B7 cDNA ORF Clone, Mouse, untagged MG51644-UT
HSD17B7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51644-ACGLN
HSD17B7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51644-ACG
HSD17B7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51644-ANG
HSD17B7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51644-ACR
HSD17B7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51644-ANR
HSD17B7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51644-NF
HSD17B7 cDNA ORF Clone, Mouse, C-His tag MG51644-CH
HSD17B7 cDNA ORF Clone, Mouse, N-His tag MG51644-NH
HSD17B7 cDNA ORF Clone, Mouse, C-HA tag MG51644-CY
HSD17B7 cDNA ORF Clone, Mouse, N-HA tag MG51644-NY
HSD17B7 cDNA ORF Clone, Mouse, C-Myc tag MG51644-CM
HSD17B7 cDNA ORF Clone, Mouse, N-Myc tag MG51644-NM
HSD17B7 qPCR Primer Pairs, Mouse MP201517

HSD17B7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD17B7 cDNA ORF Clone in Cloning Vector, Human HG13528-G
HSD17B7 cDNA ORF Clone, Human, untagged HG13528-UT
HSD17B7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13528-ACGLN
HSD17B7 cDNA ORF Clone, Human, C-GFPSpark® tag HG13528-ACG
HSD17B7 cDNA ORF Clone, Human, C-OFPSpark® tag HG13528-ACR
HSD17B7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13528-CF
HSD17B7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13528-NF
HSD17B7 cDNA ORF Clone, Human, C-His tag HG13528-CH
HSD17B7 cDNA ORF Clone, Human, N-His tag HG13528-NH
HSD17B7 cDNA ORF Clone, Human, C-HA tag HG13528-CY
HSD17B7 cDNA ORF Clone, Human, N-HA tag HG13528-NY
HSD17B7 cDNA ORF Clone, Human, C-Myc tag HG13528-CM
HSD17B7 cDNA ORF Clone, Human, N-Myc tag HG13528-NM
HSD17B7 qPCR Primer Pairs, Human HP102214
info info
添加购物车成功! 添加购物车失败!