ICOS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50466-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ICOS Reagents
CRO Services
Product recommended

All ICOS Reagents
ICOS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
603 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse inducible T-cell co-stimulator with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + NotI (6kb + 0.63kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ICOS cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICOS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5645
Mouse ICOS/AILIM/CD278 Gene Expression validated Image 16242
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ICOS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AILIM cDNA ORF Clone, Mouse;CCLP cDNA ORF Clone, Mouse;CRP-1 cDNA ORF Clone, Mouse;H4 cDNA ORF Clone, Mouse;Ly115 cDNA ORF Clone, Mouse
ICOS Background Information

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
inducible T-cell co-stimulator
References
  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • ICOS cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Cynomolgus CG90866-G

    ICOS cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Rat RG80381-G
    ICOS cDNA ORF Clone, Rat, untagged RG80381-UT
    ICOS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80381-ACGLN
    ICOS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80381-ACG
    ICOS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80381-ACR
    ICOS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80381-CF
    ICOS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80381-NF
    ICOS cDNA ORF Clone, Rat, C-His tag RG80381-CH
    ICOS cDNA ORF Clone, Rat, N-His tag RG80381-NH
    ICOS cDNA ORF Clone, Rat, C-HA tag RG80381-CY
    ICOS cDNA ORF Clone, Rat, N-HA tag RG80381-NY
    ICOS cDNA ORF Clone, Rat, C-Myc tag RG80381-CM
    ICOS cDNA ORF Clone, Rat, N-Myc tag RG80381-NM
    ICOS qPCR Primer Pairs, Rat RP300348

    ICOS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Mouse MG50466-M
    ICOS cDNA ORF Clone, Mouse, untagged MG50466-UT
    ICOS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50466-ACGLN
    ICOS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50466-ACG
    ICOS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50466-ACR
    ICOS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50466-CF
    ICOS cDNA ORF Clone, Mouse, C-His tag MG50466-CH
    ICOS cDNA ORF Clone, Mouse, N-His tag MG50466-NH
    ICOS cDNA ORF Clone, Mouse, C-HA tag MG50466-CY
    ICOS cDNA ORF Clone, Mouse, N-HA tag MG50466-NY
    ICOS cDNA ORF Clone, Mouse, C-Myc tag MG50466-CM
    ICOS cDNA ORF Clone, Mouse, N-Myc tag MG50466-NM
    ICOS qPCR Primer Pairs, Mouse MP201027

    ICOS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ICOS cDNA ORF Clone in Cloning Vector, Human HG10344-M
    ICOS cDNA ORF Clone, Human, untagged HG10344-UT
    ICOS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10344-ACGLN
    ICOS cDNA ORF Clone, Human, C-GFPSpark® tag HG10344-ACG
    ICOS cDNA ORF Clone, Human, C-OFPSpark® tag HG10344-ACR
    ICOS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10344-CF
    ICOS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10344-NF
    ICOS cDNA ORF Clone, Human, C-His tag HG10344-CH
    ICOS cDNA ORF Clone, Human, N-His tag HG10344-NH
    ICOS cDNA ORF Clone, Human, C-HA tag HG10344-CY
    ICOS cDNA ORF Clone, Human, N-HA tag HG10344-NY
    ICOS cDNA ORF Clone, Human, C-Myc tag HG10344-CM
    ICOS cDNA ORF Clone, Human, N-Myc tag HG10344-NM
    ICOS qPCR Primer Pairs, Human HP100382
    info info
    添加购物车成功! 添加购物车失败!